File:Phylo-Quizz.pdf and Qiu Lab Meetings: Difference between pages

From QiuLab
(Difference between pages)
Jump to navigation Jump to search
imported>Weigang
No edit summary
 
imported>Weigang
 
Line 1: Line 1:
==Projects & Goals==
* Borrelia population genomics: Recombination & Natural Selection (Published)
* Borrelia pan-genomics (Submitted)
* Positive and negative selection in Borrelia ORFs and IGS (In submission)
* Dr Bargonetti's project (Summer 2013)
* A population genomics pipeline using MUGSY-FastTree (Summer 2013): [[Population_Genomics_Course|Project page]]
* Borrelia Genome Database & Browser (Summer 2013) [[media:Web.png|Version 2 screen shot]]
* Pseudomonas population genomics (Summer 2013) [[Pseudomonas_population_genomics|Project page]]
*Hypothesis Testing: Do host-interacting genes show adaptive codon usage? (Summer 2013): [[Borrelia_codon_usage|Project page]]
* Phylogenomics browsing with JavaScript/JQuery, Ajax, and [http://http://www.jsphylosvg.com/ jsPhylosvg]
* Frequency distribution of ospC types in wild tick populations (Fall 2013) [[strain_natural_frequency|Project page]]
----


==Lab meeting: June 13, 2013==
* Weigang: IGS paper submission should be done by Thursday.
* Che/Slav: Workshop update (Meeting at 3:30pm?)
* Che: SILAC project (Meeting at 4pm?)
* Zhenmao: Tick processing & paired-end Illumina sequencing
* Pedro: Updates on "ncbi-orf" table
* Girish: phyloSVG extension; QuBi video
* Saymon and Deidre: consensus start-codons
* Reeyes and Raymond: Pseudomonas DB; fleN alignment and phylogeny
* Valentyna: BLASTn results (4:30pm?)
==Lab meeting: May 23, 2013==
* <font color="red">May 24, Friday: End of School Year Party in the Park (we leave from Hunter @ 1:30pm)</font>
* Recommended reading of the week: [http://www.genetics.org/content/194/1/199.abstract Detecting Neanderthal genes using the D' homoplasy statistic]
* Weigang: IGS paper submission
* Che: Thesis update/SILAC project/Summer teaching
* Zhenmao: Manuscript update: Material & Methods; Results (Tables and Figures)
* Pedro: Catlyst web framework
* Girish: cp26 phylogenomic analysis
* Saymon and Deidre: consensus start-codons
----
==Lab meeting: May 16, 2013==
* Weigang: IGS paper submitted yet?
* Che: Thesis update. Chapter 3. Evolution of ospA/ospB gene family
* Pedro/Zhenmao: Can we wrap up the BLAST identification of ospC types?
* Girish: Fetch cp26 sequences from DB; Run MUGSY & FastTree
* Saymon/Deidre: Identification of consensus start-codon positions
* Pedro/Girish: orth_get/orth_igs website development. Catalyst. Implement graphics (genome map & phylogeny) query interface
* Raymond: start the Pseudomonas summer project
----
==Foundational Readings==
* Molecular phylogenetics
* Population genetics
* Genomics
* Systems Biology
----
==Informatics Architecture==
* Operating Systems: Linux OS/Ubuntu, Mac OS
* Programming languages: BASH, Perl/BioPerl, R
* Relational Databases: PostgreSQL
* Software architecture
** bb2: Borrelia Genome Database
** bb2i: an Perl API for bb2
** DNATweezer: Perl wrappers of most frequently used BioPerl modules, including Bio::Seq, Bio::SimpleAlign, and Bio::Tree [https://sourceforge.net/p/dnatwizzer/home/Home/]
** SimBac: A Perl/Moose package for simulating bacterial genome evolution [http://sourceforge.net/projects/bacsim/files/]
** Borrelia Ortholog Retriever: Download ortholog alignments from 23 Borrelia spp genomes. Search by gene names and IDs.[http://borreliagenome.org/orth_get/]
* Hardware Setup
** NSF File Server
** Database and Application Server
** Web Server
** Linux Workstations
----
==Perl Challenges==
{| class="wikitable"
! Problem
! Input
! Output
|-
| DNA transcription
| A DNA sequence, in 5'-3' direction (e.g., aaatttaaaagacaaaaagactgctctaagtcttgaaaatttggttttcaaagatgat)
| An RNA sequence, in 5'-3' direction
|-
| Genetic code
| None
| 64 codons, one per line (using loops)
|-
| Random sequence 1
| None
| Generate a random DNA sequence (e.g., 1000 bases) with equal base frequencies
|-
| Random sequence 2
| None
| Generate a random DNA sequence with biased base frequencies, e.g., 10% G, 10% C, 40% T, and 40% A.
|-
| Graphics I
| a categorical dataset, e.g., Biology
| a bar graph & a pie char, using GD::Simple or Postscript::Simple
|}

Revision as of 17:44, 11 June 2013

Projects & Goals

  • Borrelia population genomics: Recombination & Natural Selection (Published)
  • Borrelia pan-genomics (Submitted)
  • Positive and negative selection in Borrelia ORFs and IGS (In submission)
  • Dr Bargonetti's project (Summer 2013)
  • A population genomics pipeline using MUGSY-FastTree (Summer 2013): Project page
  • Borrelia Genome Database & Browser (Summer 2013) Version 2 screen shot
  • Pseudomonas population genomics (Summer 2013) Project page
  • Hypothesis Testing: Do host-interacting genes show adaptive codon usage? (Summer 2013): Project page
  • Phylogenomics browsing with JavaScript/JQuery, Ajax, and jsPhylosvg
  • Frequency distribution of ospC types in wild tick populations (Fall 2013) Project page

Lab meeting: June 13, 2013

  • Weigang: IGS paper submission should be done by Thursday.
  • Che/Slav: Workshop update (Meeting at 3:30pm?)
  • Che: SILAC project (Meeting at 4pm?)
  • Zhenmao: Tick processing & paired-end Illumina sequencing
  • Pedro: Updates on "ncbi-orf" table
  • Girish: phyloSVG extension; QuBi video
  • Saymon and Deidre: consensus start-codons
  • Reeyes and Raymond: Pseudomonas DB; fleN alignment and phylogeny
  • Valentyna: BLASTn results (4:30pm?)

Lab meeting: May 23, 2013

  • May 24, Friday: End of School Year Party in the Park (we leave from Hunter @ 1:30pm)
  • Recommended reading of the week: Detecting Neanderthal genes using the D' homoplasy statistic
  • Weigang: IGS paper submission
  • Che: Thesis update/SILAC project/Summer teaching
  • Zhenmao: Manuscript update: Material & Methods; Results (Tables and Figures)
  • Pedro: Catlyst web framework
  • Girish: cp26 phylogenomic analysis
  • Saymon and Deidre: consensus start-codons

Lab meeting: May 16, 2013

  • Weigang: IGS paper submitted yet?
  • Che: Thesis update. Chapter 3. Evolution of ospA/ospB gene family
  • Pedro/Zhenmao: Can we wrap up the BLAST identification of ospC types?
  • Girish: Fetch cp26 sequences from DB; Run MUGSY & FastTree
  • Saymon/Deidre: Identification of consensus start-codon positions
  • Pedro/Girish: orth_get/orth_igs website development. Catalyst. Implement graphics (genome map & phylogeny) query interface
  • Raymond: start the Pseudomonas summer project

Foundational Readings

  • Molecular phylogenetics
  • Population genetics
  • Genomics
  • Systems Biology

Informatics Architecture

  • Operating Systems: Linux OS/Ubuntu, Mac OS
  • Programming languages: BASH, Perl/BioPerl, R
  • Relational Databases: PostgreSQL
  • Software architecture
    • bb2: Borrelia Genome Database
    • bb2i: an Perl API for bb2
    • DNATweezer: Perl wrappers of most frequently used BioPerl modules, including Bio::Seq, Bio::SimpleAlign, and Bio::Tree [1]
    • SimBac: A Perl/Moose package for simulating bacterial genome evolution [2]
    • Borrelia Ortholog Retriever: Download ortholog alignments from 23 Borrelia spp genomes. Search by gene names and IDs.[3]
  • Hardware Setup
    • NSF File Server
    • Database and Application Server
    • Web Server
    • Linux Workstations

Perl Challenges

Problem Input Output
DNA transcription A DNA sequence, in 5'-3' direction (e.g., aaatttaaaagacaaaaagactgctctaagtcttgaaaatttggttttcaaagatgat) An RNA sequence, in 5'-3' direction
Genetic code None 64 codons, one per line (using loops)
Random sequence 1 None Generate a random DNA sequence (e.g., 1000 bases) with equal base frequencies
Random sequence 2 None Generate a random DNA sequence with biased base frequencies, e.g., 10% G, 10% C, 40% T, and 40% A.
Graphics I a categorical dataset, e.g., Biology a bar graph & a pie char, using GD::Simple or Postscript::Simple

The following page uses this file: