File:Phylo-Quizz.pdf and Qiu Lab Meetings: Difference between pages
(Difference between pages)
Jump to navigation
Jump to search
imported>Weigang No edit summary |
imported>Weigang |
||
Line 1: | Line 1: | ||
==Projects & Goals== | |||
* Borrelia population genomics: Recombination & Natural Selection (Published) | |||
* Borrelia pan-genomics (Submitted) | |||
* Positive and negative selection in Borrelia ORFs and IGS (In submission) | |||
* Dr Bargonetti's project (Summer 2013) | |||
* A population genomics pipeline using MUGSY-FastTree (Summer 2013): [[Population_Genomics_Course|Project page]] | |||
* Borrelia Genome Database & Browser (Summer 2013) [[media:Web.png|Version 2 screen shot]] | |||
* Pseudomonas population genomics (Summer 2013) [[Pseudomonas_population_genomics|Project page]] | |||
*Hypothesis Testing: Do host-interacting genes show adaptive codon usage? (Summer 2013): [[Borrelia_codon_usage|Project page]] | |||
* Phylogenomics browsing with JavaScript/JQuery, Ajax, and [http://http://www.jsphylosvg.com/ jsPhylosvg] | |||
* Frequency distribution of ospC types in wild tick populations (Fall 2013) [[strain_natural_frequency|Project page]] | |||
---- | |||
==Lab meeting: June 13, 2013== | |||
* Weigang: IGS paper submission should be done by Thursday. | |||
* Che/Slav: Workshop update (Meeting at 3:30pm?) | |||
* Che: SILAC project (Meeting at 4pm?) | |||
* Zhenmao: Tick processing & paired-end Illumina sequencing | |||
* Pedro: Updates on "ncbi-orf" table | |||
* Girish: phyloSVG extension; QuBi video | |||
* Saymon and Deidre: consensus start-codons | |||
* Reeyes and Raymond: Pseudomonas DB; fleN alignment and phylogeny | |||
* Valentyna: BLASTn results (4:30pm?) | |||
==Lab meeting: May 23, 2013== | |||
* <font color="red">May 24, Friday: End of School Year Party in the Park (we leave from Hunter @ 1:30pm)</font> | |||
* Recommended reading of the week: [http://www.genetics.org/content/194/1/199.abstract Detecting Neanderthal genes using the D' homoplasy statistic] | |||
* Weigang: IGS paper submission | |||
* Che: Thesis update/SILAC project/Summer teaching | |||
* Zhenmao: Manuscript update: Material & Methods; Results (Tables and Figures) | |||
* Pedro: Catlyst web framework | |||
* Girish: cp26 phylogenomic analysis | |||
* Saymon and Deidre: consensus start-codons | |||
---- | |||
==Lab meeting: May 16, 2013== | |||
* Weigang: IGS paper submitted yet? | |||
* Che: Thesis update. Chapter 3. Evolution of ospA/ospB gene family | |||
* Pedro/Zhenmao: Can we wrap up the BLAST identification of ospC types? | |||
* Girish: Fetch cp26 sequences from DB; Run MUGSY & FastTree | |||
* Saymon/Deidre: Identification of consensus start-codon positions | |||
* Pedro/Girish: orth_get/orth_igs website development. Catalyst. Implement graphics (genome map & phylogeny) query interface | |||
* Raymond: start the Pseudomonas summer project | |||
---- | |||
==Foundational Readings== | |||
* Molecular phylogenetics | |||
* Population genetics | |||
* Genomics | |||
* Systems Biology | |||
---- | |||
==Informatics Architecture== | |||
* Operating Systems: Linux OS/Ubuntu, Mac OS | |||
* Programming languages: BASH, Perl/BioPerl, R | |||
* Relational Databases: PostgreSQL | |||
* Software architecture | |||
** bb2: Borrelia Genome Database | |||
** bb2i: an Perl API for bb2 | |||
** DNATweezer: Perl wrappers of most frequently used BioPerl modules, including Bio::Seq, Bio::SimpleAlign, and Bio::Tree [https://sourceforge.net/p/dnatwizzer/home/Home/] | |||
** SimBac: A Perl/Moose package for simulating bacterial genome evolution [http://sourceforge.net/projects/bacsim/files/] | |||
** Borrelia Ortholog Retriever: Download ortholog alignments from 23 Borrelia spp genomes. Search by gene names and IDs.[http://borreliagenome.org/orth_get/] | |||
* Hardware Setup | |||
** NSF File Server | |||
** Database and Application Server | |||
** Web Server | |||
** Linux Workstations | |||
---- | |||
==Perl Challenges== | |||
{| class="wikitable" | |||
! Problem | |||
! Input | |||
! Output | |||
|- | |||
| DNA transcription | |||
| A DNA sequence, in 5'-3' direction (e.g., aaatttaaaagacaaaaagactgctctaagtcttgaaaatttggttttcaaagatgat) | |||
| An RNA sequence, in 5'-3' direction | |||
|- | |||
| Genetic code | |||
| None | |||
| 64 codons, one per line (using loops) | |||
|- | |||
| Random sequence 1 | |||
| None | |||
| Generate a random DNA sequence (e.g., 1000 bases) with equal base frequencies | |||
|- | |||
| Random sequence 2 | |||
| None | |||
| Generate a random DNA sequence with biased base frequencies, e.g., 10% G, 10% C, 40% T, and 40% A. | |||
|- | |||
| Graphics I | |||
| a categorical dataset, e.g., Biology | |||
| a bar graph & a pie char, using GD::Simple or Postscript::Simple | |||
|} |
Revision as of 17:44, 11 June 2013
Projects & Goals
- Borrelia population genomics: Recombination & Natural Selection (Published)
- Borrelia pan-genomics (Submitted)
- Positive and negative selection in Borrelia ORFs and IGS (In submission)
- Dr Bargonetti's project (Summer 2013)
- A population genomics pipeline using MUGSY-FastTree (Summer 2013): Project page
- Borrelia Genome Database & Browser (Summer 2013) Version 2 screen shot
- Pseudomonas population genomics (Summer 2013) Project page
- Hypothesis Testing: Do host-interacting genes show adaptive codon usage? (Summer 2013): Project page
- Phylogenomics browsing with JavaScript/JQuery, Ajax, and jsPhylosvg
- Frequency distribution of ospC types in wild tick populations (Fall 2013) Project page
Lab meeting: June 13, 2013
- Weigang: IGS paper submission should be done by Thursday.
- Che/Slav: Workshop update (Meeting at 3:30pm?)
- Che: SILAC project (Meeting at 4pm?)
- Zhenmao: Tick processing & paired-end Illumina sequencing
- Pedro: Updates on "ncbi-orf" table
- Girish: phyloSVG extension; QuBi video
- Saymon and Deidre: consensus start-codons
- Reeyes and Raymond: Pseudomonas DB; fleN alignment and phylogeny
- Valentyna: BLASTn results (4:30pm?)
Lab meeting: May 23, 2013
- May 24, Friday: End of School Year Party in the Park (we leave from Hunter @ 1:30pm)
- Recommended reading of the week: Detecting Neanderthal genes using the D' homoplasy statistic
- Weigang: IGS paper submission
- Che: Thesis update/SILAC project/Summer teaching
- Zhenmao: Manuscript update: Material & Methods; Results (Tables and Figures)
- Pedro: Catlyst web framework
- Girish: cp26 phylogenomic analysis
- Saymon and Deidre: consensus start-codons
Lab meeting: May 16, 2013
- Weigang: IGS paper submitted yet?
- Che: Thesis update. Chapter 3. Evolution of ospA/ospB gene family
- Pedro/Zhenmao: Can we wrap up the BLAST identification of ospC types?
- Girish: Fetch cp26 sequences from DB; Run MUGSY & FastTree
- Saymon/Deidre: Identification of consensus start-codon positions
- Pedro/Girish: orth_get/orth_igs website development. Catalyst. Implement graphics (genome map & phylogeny) query interface
- Raymond: start the Pseudomonas summer project
Foundational Readings
- Molecular phylogenetics
- Population genetics
- Genomics
- Systems Biology
Informatics Architecture
- Operating Systems: Linux OS/Ubuntu, Mac OS
- Programming languages: BASH, Perl/BioPerl, R
- Relational Databases: PostgreSQL
- Software architecture
- bb2: Borrelia Genome Database
- bb2i: an Perl API for bb2
- DNATweezer: Perl wrappers of most frequently used BioPerl modules, including Bio::Seq, Bio::SimpleAlign, and Bio::Tree [1]
- SimBac: A Perl/Moose package for simulating bacterial genome evolution [2]
- Borrelia Ortholog Retriever: Download ortholog alignments from 23 Borrelia spp genomes. Search by gene names and IDs.[3]
- Hardware Setup
- NSF File Server
- Database and Application Server
- Web Server
- Linux Workstations
Perl Challenges
Problem | Input | Output |
---|---|---|
DNA transcription | A DNA sequence, in 5'-3' direction (e.g., aaatttaaaagacaaaaagactgctctaagtcttgaaaatttggttttcaaagatgat) | An RNA sequence, in 5'-3' direction |
Genetic code | None | 64 codons, one per line (using loops) |
Random sequence 1 | None | Generate a random DNA sequence (e.g., 1000 bases) with equal base frequencies |
Random sequence 2 | None | Generate a random DNA sequence with biased base frequencies, e.g., 10% G, 10% C, 40% T, and 40% A. |
Graphics I | a categorical dataset, e.g., Biology | a bar graph & a pie char, using GD::Simple or Postscript::Simple |
File usage
The following page uses this file: