In [1]:
# Exercise 1.
# Extract the third character in the string and change it to uppercase. Print the result.

string = 'Hello, World!'
In [2]:
# Exercise 2.
# Extract the 5th, 7th, and 9th characters in the  number string. Sum them and print the result.

num_string = '783264811953678991250'
In [3]:
# Exercise 3.
# Replace every '0' with '1'. Print the result.

binary_str = '10100001000100101110010100100111101001000100010101011100010'
In [4]:
# Exercise 4.
# Multiply the 5th and last elements of the given list. Print the result. 

lst = [12, 7, 42.2, 66, -4, -21, 7, 65, 12, 8, -1, 9]
In [5]:
# Exercise 5.
# Print the first 3 elements of the given list.

subjects = ['Biology', 'History', 'Chemistry', 'Calculus', 'English']
In [6]:
# Exercise 6.
# Create a new list where each number in the given list is converted to a string type.

nums = [22, 34, 3.14, 42, 0, 11.2]
In [7]:
# Exercise 7.
# Remove strings that are longer than 6 characters. Print the modified list. 

string_list = ['borrelia', 'tick', 'evolution', 'tree', 'bioinformatics', 'bio', 'analysis', 'lyme', 'data']
In [8]:
# Exercise 8.
# Count the number of G's and C's in the given string.

dna = "GAGCACATATGAGAGTGTTAGAACTGGACGTGCGGTTTCTCTGCGAAGAACACCTCGAGCTGTTGCGTTGTTGCGCTGCCTAGATGCAGT"
In [9]:
# Exercise 9.
# Use list comprehension to create a new list where every word from the old list is in uppercase and has an
# exclamation point after it. Example: 'word' --> 'WORD!'

words = ['hello', 'world', 'python', 'genetics', 'rna', 'protein']
In [10]:
# Exercise 10.
# Use list comprehension to create a new list of numbers where each odd number in the given list is multiplied by 5.

numbers = [3, 4, 78, 56, 32, 11, 91, 0, 39, 99, 101, 222, 43]
In [11]:
# Exercise 11.
# Convert the given sequence of codons into one string.

codons = 'atg, caa, aag, gat, cca, tgt, ttc, cgg'
In [12]:
# Exercise 12.
# Write a function that takes in a list of numbers and returns the mean value.

nums = [632, 540, 311, 784, 421, 500, 889, 720, 613]
In [13]:
# Exercise 13.
# Write a function that performs trancription on a given DNA string and returns an RNA string.
# Base pairs: a-u, c-g, , g-c, t-a

dna1 = 'acacggcttaa'
dna2 = 'tcaaccgttcagtga'
In [14]:
# Exercise 14.
# Create a new list containing sums of each inner list.

nested_list = [[34, 56, -22, -4, 29],
               [56, 92, 102, 121, 7],
               [92, 37, 80, -12, 35],
               [-9, 0, -15, -23, 56],
               [23, 54, 37, 120, 57]]
In [15]:
# Exercise 15.
# Write a function that takes in a sentence string and returns a dictionary where every key is a word of the
# sentence and every value is the length of that word.

string = 'The quick brown fox jumps over the lazy dog'
In [16]:
# Exercise 16.
# Print the last row of the given 2D array.
import numpy as np
array = np.array([[34, 56, -22, -4, 29],
                  [56, 92, 102, 121, 7],
                  [92, 37, 80, -12, 35],
                  [-9, 0, -15, -23, 56],
                  [23, 54, 37, 120, 57]])
In [17]:
# Exercise 17.
# Print the first three rows of the given array.

array = np.array([[34, 56, -22, -4, 29],
                  [56, 92, 102, 121, 7],
                  [92, 37, 80, -12, 35],
                  [-9, 0, -15, -23, 56],
                  [23, 54, 37, 120, 57]])
In [18]:
# Exercise 18.
# Print the first element of the second row.

array = np.array([[34, 56, -22, -4, 29],
                  [56, 92, 102, 121, 7],
                  [92, 37, 80, -12, 35],
                  [-9, 0, -15, -23, 56],
                  [23, 54, 37, 120, 57]])
In [19]:
# Exercise 19.
# Print columns 2 and 4 of the given array.

array = np.array([[34, 56, -22, -4, 29],
                  [56, 92, 102, 121, 7],
                  [92, 37, 80, -12, 35],
                  [-9, 0, -15, -23, 56],
                  [23, 54, 37, 120, 57]])
In [20]:
# Exercise 20.
# Select all negative values of the given array.

array = np.array([[34, 56, -22, -4, 29],
                  [56, 92, 102, 121, 7],
                  [92, 37, 80, -12, 35],
                  [-9, 0, -15, -23, 56],
                  [23, 54, 37, 120, 57]])
In [21]:
# Use the dataframe below to complete the exercises.
import pandas as pd
data = [[5.1, 3.5, 1.4, 0.2, 'Setosa'],
        [4.9, 3.0, 1.4, 0.2, 'Setosa'],
        [6.5, 3.0, 5.2, 2.0, 'Virginica'],
        [7.0, 3.2, 4.7, 1.4, 'Versicolor'],
        [5.9, 3.2, 4.8, 1.8, 'Versicolor'],
        [6.3, 3.3, 6.0, 2.5, 'Virginica']]

cols = ['sepal.length', 'sepal.width', 'petal.length', 'petal.width', 'variety']
df = pd.DataFrame(data, columns = cols)
df
Out[21]:
sepal.length sepal.width petal.length petal.width variety
0 5.1 3.5 1.4 0.2 Setosa
1 4.9 3.0 1.4 0.2 Setosa
2 6.5 3.0 5.2 2.0 Virginica
3 7.0 3.2 4.7 1.4 Versicolor
4 5.9 3.2 4.8 1.8 Versicolor
5 6.3 3.3 6.0 2.5 Virginica
In [22]:
# Exercise 21.
# Print the sepal.length and petal.width columns using labels.
In [23]:
# Exercise 22.
# Print the first 3 columns using labels.
In [24]:
# Exercise 23.
# Print rows 3-5 using integer indexing.
In [25]:
# Exercise 24.
# Select the third column using integer indexing.
In [26]:
# Exercise 25.
# Print the mean of the petal.length column.
In [27]:
# Exercise 26.
# Print the sums of all length columns
In [28]:
# Exercise 27.
# Plot a line chart. Label the axes and add a title. 
%matplotlib inline
import matplotlib.pyplot as plt
x = [0.2, 0.6, 0.8, 1.2, 1.6]
y = [0.4, 1.2, 1.6, 2.4, 3.2]