Bioinformatics Workshop 2014

Github for sharing data and source code

• SSH setup (github no longer allows password-based push to remote repository)

1. Create a new SSH key on your computer
2. Add the key to your Github account
3. Commit with SSH

• Developer workflow
  • Clone remote repository: git clone <rep-name.git>
  • Sync local to remote repository: git pull
  • Check local repository status: git status
  • Show the latest commit: git log
  • Add new file: git add <filename>
  • Commit changes to local repository: git commit -a -m "message"
  • Push to remote repository: git push

bcftools pipeline

bcftools view -m2 -M2 --types snps calls.bcf > snps.bcf vcftools --vcf snps4.vcf --maf 0.01 --recode --recode-INFO-all --out maf (n=33 SNPs) bcftools query -l maf.recode.vcf > samples (n=17775 samples) cat samples | while read line; do echo ">$line"; bcftools query -s "$line" -f '[%TGT]' maf.recode.vcf; echo; done > samples-maf.fas

R tips

multiple regression models (with broom::tidy)

library(broom)
compensation.models <- compensation %>% group_by(Grazing) %>% do(tidy(lm(Fruit ~ Root, data = .)))

multiple regression models (with nested tibble)

# build multiple models, one for each serum:
by_serum <- two_od %>% group_by(Serum) %>% nest() # nested data frame, one row per serum
x_model <- function(df) { # model function (similar to lapply)
  x <- df %>% filter(OspC!='A02' & OspC!='A04')
#  x <- df %>% filter(OspC!='A02' & OspC!='A04' & OspC!='N14')
  lm(OD1 ~ OD2, data = x)
}

by_serum <- by_serum %>% mutate(model = map(data, x_model)) # add model to each serum

output <- vector("list")
for(i in 1:length(by_serum$Serum)) {
  df <- by_serum$data[[i]]
  model <- by_serum$model[[i]]
  pd <- predict.lm(model, newdata = data.frame(OD2 = df$OD2))
  output[[i]] <- data.frame(OspC = df$OspC,
                            OD2 = df$OD2,
                            OD1 = df$OD1,
                            OD1_pred = pd,
                            Serum = rep(by_serum$Serum[i], nrow(df))
                                        )
}
df.out <- bind_rows(output)

multiple regression models (with custum functions)

# build model
models <- xy %>% split(.$Serum) %>% map(~lm( aff_PL ~ aff_C3H, data= .))

# get r-squared:
models %>% map(summary) %>% map_dbl("adj.r.squared")

# get p values (of slope, using a custom function):
get.pvalue <- function(x){
  s <- summary(x); 
  s$coefficients[2, 4]
}
models %>% map(get.pvalue) %>% unlist()

# get slope:
get.slope <- function(x){
  s <- summary(x); 
  s$coefficients[2, 1]
}
models %>% map(get.slope) %>% unlist()

# get intercept:
get.intercept <- function(x){
  s <- summary(x); 
  s$coefficients[1, 1]
}
models %>% map(get.intercept) %>% unlist()

genome alignment with MUMMER4

1. MUMMER 4 homepage: MUMMER4
2. align two genomes, output delta file:
   1. nucmer -p A909-COH1 COH1.fa A909.fa
   2. dnadiff -p A909-COH1 -d A909-COH1.delta
   3. less A909-ref.report, OR grep AvgIdentity A909-ref.report
3. output sam file
   1. nucmer --sam-long=COH1 B111.fa COH1.fa
   2. samtools view -b COH1.sam -T B111.fa > COH1.bam
   3. samtools sort COH1.bam -o COH1.sorted.bam
   4. samtools index COH1.sorted.bam
4. Use GSAlign

conda config --add channels defaults
conda config --add channels bioconda
conda config --add channels conda-forge
conda install gsalign
gsalign index ref.fas cov
gsalign -i cov -q test.fas

1. bcf annotate with gff file:

bcftools csq -f ../ensembl-B31-downloads/lp54.fa -g ../ensembl-B31-downloads/lp54.gff3 -Ov -o lp54.anno.vcf lp54.vcf

1. variant call with bcftools: https://samtools.github.io/bcftools/howtos/variant-calling.html
2. bcftools cheatsheet: https://gist.github.com/elowy01/93922762e131d7abd3c7e8e166a74a0b

BERT classifier

• Project start: Winter 2020
• Project team: Saadmanul Islam <Saadmanul.Islam91@myhunter.cuny.edu>
• Tutorial page: https://medium.com/swlh/a-simple-guide-on-using-bert-for-text-classification-bbf041ac8d04
• Data set: bioluminascence
• Goal: cross validation

Estimate LD50 using GLM

## curves
library(dplyr)
library(ggplot2)
library(growthcurver)
library(reshape2)
library(purrr)
setwd("/Users/desireepante/Desktop/Programming")
OD20<-read.csv("OD_0220.csv")
OD220<-OD20[-c(6,11:12,20,26:28, 32:33,45:47),]
od <- filter(OD220, IPTG == 0);

#N15
od15d <- mutate(od15d, od.norm = OD/max(OD))
test.1<-glm(min ~ OD, data= od15d, family= "binomial")
ilink<-family(test.1)$linkinv
test.1.pd <- with(od15d,
                  data.frame(min = seq(min(min), max(min),
                                       length = 10)))
test.1.pd <- cbind(test.1.pd, predict(test.1, test.1.pd, type = "link", se.fit = TRUE)[1:2])
test.1.pd <- transform(test.1.pd, Fitted = ilink(fit), Upper = ilink(fit + ( se.fit)),
                       Lower = ilink(fit - ( se.fit)))

test.test<-ggplot(od15d, aes(x = min, y = od.norm)) +
  geom_ribbon(data = test.1.pd, aes(ymin = Lower, ymax = Upper, x = min),
              fill = "steelblue2", alpha = 0.2, inherit.aes = FALSE) +
  geom_line(data = test.1.pd, aes(y = Fitted, x = min)) +
  geom_point()
test.test

1k genome project/VCFTools

# Extract APOL1 locus
vcftools --gzvcf ALL.chr22.phase3_shapeit2_mvncall_integrated_v5a.20130502.genotypes.vcf.gz --from-bp 36253071 --to-bp 36267530 --recode --stdout --recode-INFO-all --chr 22 | gzip -c > apol1.vcf.gz

# allele frequencies/counts
vcftools --vcf pvt1.recode.vcf --keep AFR.supergroup --counts --out afr

# pi

# Fst
vcftools --weir-fst-pop AFR.supergroup --weir-fst-pop AMR.supergroup --vcf pvt1.recode.vcf --out AFR-AMR  --remove-indels
vcftools --weir-fst-pop AFR.supergroup --weir-fst-pop EAS.supergroup --vcf pvt1.recode.vcf --out AFR-EAS  --remove-indels
vcftools --weir-fst-pop AFR.supergroup --weir-fst-pop EUR.supergroup --vcf pvt1.recode.vcf --out AFR-EUR  --remove-indels
vcftools --weir-fst-pop AFR.supergroup --weir-fst-pop SAS.supergroup --vcf pvt1.recode.vcf --out AFR-SAS  --remove-indels
vcftools --weir-fst-pop AMR.supergroup --weir-fst-pop EAS.supergroup --vcf pvt1.recode.vcf --out AMR-EAS  --remove-indels
vcftools --weir-fst-pop AMR.supergroup --weir-fst-pop EUR.supergroup --vcf pvt1.recode.vcf --out AMR-EUR  --remove-indels
vcftools --weir-fst-pop AMR.supergroup --weir-fst-pop SAS.supergroup --vcf pvt1.recode.vcf --out AMR-SAS  --remove-indels
vcftools --weir-fst-pop EAS.supergroup --weir-fst-pop EUR.supergroup --vcf pvt1.recode.vcf --out EAS-EUR  --remove-indels
vcftools --weir-fst-pop EAS.supergroup --weir-fst-pop SAS.supergroup --vcf pvt1.recode.vcf --out EAS-SAS  --remove-indels
vcftools --weir-fst-pop EUR.supergroup --weir-fst-pop SAS.supergroup --vcf pvt1.recode.vcf --out EUR-SAS  --remove-indels

# concatenate vcf from different chromosomes
vcf-concat apol1-exon-6-snps.vcf tvp23-exon-1-snps.vcf hpr-exon-5-snps.vcf > 3-exons.vcf

# vcf to tabular format
bcftools query -f '%CHROM\t%POS\t%ID\t%REF\t%ALT[\t%SAMPLE=%GT]\n' 3-exons.vcf > tmp

vcf-query -f '%CHROM\t%POS\t%ID\t%REF\t%ALT[\t%SAMPLE=%GT]\n' 3-exons.vcf > tmp

Ggplot2 tips

• Data binning and nice histograms with density and boxplot:

R binning

# numerical vector as factor so that it is sorted numerically (no need for as.character())
x.df$train.size <- as.factor(x.df$train.size)

# jitter by group
ggplot(x.df, aes(x=rate.cat, y=accuracy, color=group)) +  geom_boxplot(position=position_dodge(0.8)) + geom_jitter(position=position_jitterdodge(0.8)) + facet_wrap(~train.size, nrow = 1) + ylim(0,1) + geom_abline(intercept = 0.5, slope = 0, linetype="dashed") + theme(legend.position = "bottom")

Capture results in R/GA example

# in general use
lapply(seq_along(x), function(i) {name=names(x}[i]) 
# to capture names
# save to a data.frame
# bind into a single data.frame using dplyr function:
x.df <-bind_rows(x.rate)

library(stringdist)
library(ggplot2)

out.fit <- lapply(seq(from = 5,to = 150, by = 5), function (num.epi) {
  num.alle <- 20; # num of antigens
  epi.fit <- function(x) { # fitness defined by the minimum pair diff
    x.list <- split(x, rep(1:num.alle, each=num.epi))
    #  sum(seq_distmatrix(x.list, method = "hamming"))/(num.alle * (num.alle-1) / 2)/num.epi # average pairwise diff
    min(seq_distmatrix(x.list, method = "hamming"))/num.epi # min diff
  } 
  epi.ga <- ga(type = "binary", fitness = epi.fit, nBits = num.epi * num.alle)
  c(all = num.alle, epi = num.epi, min.pair.dist = epi.ga@fitnessValue)
})

epi.df <- t(as.data.frame(out.fit))
rownames(epi.df) <- 1:nrow(epi.df)
ggplot(as.data.frame(epi.df), aes(x=epi, y=min.pair.dist)) + geom_point() + geom_line()

NCI Cloud (Seven Bridges)

• Documentation: http://www.cancergenomicscloud.org/controlled-access-data/
• API Documentation (to access meta-data)
• Steps (June 20, 2018)
  • Create project
  • Data -> Data Overview -> Select cancer type -> Data Browser
  • Copy files to project
  • Go to project, "add filter", filter by "experimental strategy" (RNA-SEQ, miRNA-SEQ)
  • To download files: select & Download link; run aria2c -i download-links.txt
  • To download meta data: Download manifest
• Steps (better)

1. Create project
2. Search "Public Apps"
3. Load data & Run

• Steps (a little hard to follow)

1. Create project
2. Data -> Data Overview -> Select cancer type -> Data Browser
3. Click File to add property (e.g., "miRNA") -> "Copy Files to Project" -> choose project to add & add a tag to the files
4. Go to Project -> Files -> filter files by tag name -> select -> Save
5. Choose a public protocol/workflow (e.g., RNA-SEQ alignment)
6. Add index and GTF files
7. Go to Project -> task -> run

Reloop a circular plasmid from PacBio assembly

1. Input file: Z9-cp26.fa (containing overlapping ends); b31-cp26.fa (reference)
2. Find overlap ends by blasting against itself: blastn -task megablast -query Z9-cp26.fa -subject Z9-cp26.fa -evalue 1e-100 -outfmt 6
3. The result says “1 -7617” is the same as “26489-34118”, so we use bioseq to remove overlapping part: bioseq –s”1,26488” Z9-cp26.fa > Z9-cp26.fa2
4. Run numcer against b31-cp26 to identify the starting position: nucmer --coord ../b31-cp26.fa Z9-cp26.fa2
5. The result says the first base of B31 corresponds to 22171 at Z9-cp26, so we run bioseq to reloop: bioseq –R 22171 Z9-cp26.fa2 > Z9-cp26.fa3
6. Run numcer to confirm: nucmer --coord ../b31-cp26.fa Z9-cp26.fa3

KEGG REST API

# Author: Edgaras Bezrucenkovas
# Date: Nov 12, 2017
#KEGG API
#Obtain module pathways and orthologs from KEGG pa14 database

#Import module to fetch the data from KEGG database
import urllib.request
import re             #Regular expressions


#Get PA14 modules
kegg_db = "http://rest.kegg.jp/link/module/pau"
pa14_mdata = urllib.request.urlopen(kegg_db).read().decode('utf-8').splitlines()
pa14_mods = []
for line in pa14_mdata:
    line = line.split("\t")
    mod = line[1].strip("md:pau_")
    pa14_mods.append(mod)

#Get PA14 genes
kegg_db = "http://rest.kegg.jp/link/pau/module"
pa14_gdata = urllib.request.urlopen(kegg_db).read().decode('utf-8').splitlines()
pa14_genes = []
for line in pa14_gdata:
    gdata = line.split("\t")
    gdata[0] = gdata[0].strip("md:pau_")
    gdata[1] = gdata[1].strip("pau:")
    pa14_genes.append(gdata)
    
#Open the file containing KEGG compounds ids
id_file = open("kegg-entries.txt")
kegg_ids = id_file.readlines()
compound_ids = []
for cid in kegg_ids:
    cid = cid.strip("\n")
    compound_ids.append(cid)
id_file.close()

#Get module pathway ids
for cid in compound_ids:
    kegg_db = "http://rest.kegg.jp/link/module/compound:"+cid
    module_data = urllib.request.urlopen(kegg_db).read().decode('utf-8').splitlines()
    module_ids = []
    for line in module_data:
        if re.match("cpd", line):
            line = line.split("\t")
            m_id = line[1].strip("md:")
            module_ids.append(m_id)
        else:
            module_ids.append("NA")
            
    #Filter module pathway ids
    modules_final = []
    for m_id in module_ids:
        if m_id == "NA":
            modules_final.append("NA")
        elif m_id in pa14_mods:
            modules_final.append(m_id)
    if not modules_final:
        modules_final.append("NA")

    #Get genes
    genes = {}
    for m_id in modules_final:
        key = m_id
        genes.setdefault(key, [])
        if m_id == "NA":
            genes[key].append("NA")
        else:
            for i in pa14_genes:
                if m_id == i[0]:
                    genes[key].append(i[1])
                    
    #Get module names using module ids
    module_names = {}
    for m_id in modules_final:
        if m_id == "NA":
            m_name = {"NA":"NA"}
            module_names.update(m_name)
        else:
            kegg_db = "http://rest.kegg.jp/list/module:"+m_id
            module_data = urllib.request.urlopen(kegg_db).read().decode("utf-8").split("\t")
            module_name = module_data[1].strip("\n")
            m = {m_id:module_name}
            module_names.update(m)

    #Output
    for k, v in genes.items():
        for i in v:
            print(cid,k,i,module_names.get(k), sep = "\t")

D3js Tutorial

1. Install brackets editor from adobe: http://brackets.io/
2. Enable web server & create a directory "public_html" in your home directory
3. Create the following file structure: test/index.html; test/js/index.js; test/css/index.css
4. Basic D3: following this link
5. Metabolomics: following this link

Transform a wide data frame to a long one

• A function in R

df2long = function(x, varname, cname, rname){
  num.col = dim(x)[2]
  x$tmp = rownames(x)
  y = reshape(x, varying=1:num.col, v.names=varname, timevar=cname, times=names(x)[1:num.col], direction="long")
  y=y[,-4]
  rownames(y)=NULL
  colnames(y)[1] = rname
  y
}

• A function in Perl

#!/usr/bin/env perl
# expect a data frame with row and col headings
use strict;
use warnings;
use Data::Dumper;

my $first = 0;
my @colnames;
my %data;
while(<>) {
    chomp;
    $first++;
    if ($first == 1) {
        @colnames = split;
        next;
    }

    my @data = split;
    my $rowname = shift @data;
    for (my $i=0; $i<=$#data; $i++) {
        $data{$rowname}->{$colnames[$i]} = $data[$i];
    }
}

#print Dumper(\%data);

foreach my $row (keys %data) {
    foreach my $col (@colnames) {
        print $row, "\t", $col, "\t", $data{$row}->{$col}, "\n";
    }
}

exit;

Variant call with samtools/bcftools & variant verification using IGV

1. mpileup: samtools mpileup -uf ref.fa sorted1.bam sorted2.bam ...
2. call variants: bcftools call -mv > var.raw.vcf OR: bcftools call -c -v --ploidy 1 gbs-50.mpileup > raw.vcf
3. extract only SNP sites: vcftools --vcf input_file.vcf --remove-indels --recode --recode-INFO-all
4. filter by quality: bcftools filter -i '%QUAL>200' gbs50-snps.recode.vcf > gbs50-snps2.vcf
5. check by TsTv: bcftools stats gbs50-snps2.vcf | grep TSTV
6. Extract SNPs into Fasta:
   1. Or, with bcftools: bcftools query -l gbs50-snps2.vcf > samples
   2. cat samples | while read line; do echo ">$line"; bcftools query -s "$line" -f '[%TGT]' gbs50-snps2.vcf; echo; done > samples.fas
   3. get ref seq: echo ">ref" >> sample.fas; grep "^CP" gbs50-snps2.vcf | cut -f4 | paste -s -d >> sample.fas
7. Visualization with IGB
   1. Prepare & load reference genomes
   2. Load FASTA: bioseq -i'genbank' ref.gb > ref.fas
   3. Prepare GFF3 file: bp_genbank2gff3.pl --CDS --filter exon --filter gene /home/chongdi/michelle/pa_rp73.gb
8. Prepare BAM files (see below on how to index and align reads using bwa and samtools, in "ospC Amplicon")
9. Index sorted bam files with samtools & load BAM files (multiple bam files okay)

KRAKEN

1. assigns taxonomic labels to short DNA reads by examining the k-mers within a read and querying a database with those k-mers: kraken -db /belfer-ebox/projects/old_backup/qiulab/minikraken_20141208 --fastq-input 02015P1_S18_L001_R1_001.fastq.gz 02015P1_S18_L001_R2_001.fastq.gz --gzip-compressed --output outfile --paired
2. summarize taxonomy: kraken-translate --db /belfer-ebox/projects/old_backup/qiulab/minikraken_20141208 outfile > predict.file
3. count unique strains: pat-8]$ cut -f2 s75.predict | cut -f10 -d';' | grep "^[a-zA-Z]" | sort | uniq -c | sort -rn.
4. Pick the strain with the highest counts as the reference genome

PATRIC microbial genome annotation CLI

• Install Debian distribution from github: https://github.com/PATRIC3/PATRIC-distribution/releases/tag/1.015
• Tutorial: http://tutorial.theseed.org/PATRIC-Tutorials/
• Fetch all genomes from a genus: p3-all-genomes --in genome_name,Borrelia > Borrelia.genomes; p3-get-genome-data -i Borrelia.genomes -e genome_status,complete > Borrelia-complete.genomes
• Retrieves features from coding sequences only: input file must be a list of genome ids with a header! p3-get-genome-features -i $file -e feature.feature_type,CDS -a pgfam_id -a patric_id -a plfam_id -a start -a end -a strand -a genome_name -a product -a accession > ${name}-all-features.txt
• Retrieve feature sequence: p3-echo -t feature.accession "fig|100177.4.peg.1" | p3-get-feature-sequence --dna
• Submit genomes for annotation

1. Log in: p3-login user name/password
2. Submit a genome for annotation:
   1. submit-patric-annotation --scientific-name "Pseudomonas aeruginosa" --taxonomy-id 287 --genetic-code 11 --domain Bacteria --log pa.log /weigang@patricbrc.org/home/wsdir gid_5.fas
   2. submit-patric-annotation --scientific-name "Streptococcus agalactiae" --taxonomy-id 1311 --genetic-code 11 --domain Bacteria --log sa-1.log /weigang@patricbrc.org/home/wsdir sa-1.fas
   3. Message: "Uploading gid_5.fas to workspace at /weigang@patricbrc.org/home/wsdir/gid_5/gid_5.fas”
3. Create genome groups
   1. login
   2. cat trep.complete.ids | p3-put-genome-group "Treponema complete”
   3. p3-get-genome-group "Treponema complete”

Parsimony reconstruction using MPR

# MPR for each column
plot.mpr <- function(column=1) {
  plot.phylo(tr.unrooted, main = paste(colnames(ph.t)[column]))
  tmpr<-MPR(ph.t[,column], tr.unrooted, outgroup = "gid_1311.1320")
  nodelabels(paste("[", tmpr[, 1], ",", tmpr[, 2], "]", sep = "")) 
  tiplabels(ph.t[,column][tr.unrooted$tip.label], adj = -2)
}

# add internal node states
datalist <- data.frame(fam=character(), a=numeric(), b=numeric(), c=numeric())
for (i in 1:ncol(ph.t)) {
#for (i in 1:10) {
  tmpr<-MPR(ph.t[,i], tr.unrooted, outgroup = "gid_1311.1320");
  out<-c(colnames(ph.t)[i],tmpr[,1])
  datalist <- rbind(datalist, data.frame(fam=colnames(ph.t)[i], a=tmpr[1,1], b=tmpr[2,1], c=tmpr[3,1])) 
}
#plotting gains and losses
tr.unrooted <- unroot(tr)
gains<-apply(ph.node.states[,9:15], 2, function(x) length(which(x>0)))
losses<-apply(ph.node.states[,9:15], 2, function(x) length(which(x<0)))
plot(tr.unrooted)
edgelabels(gains, adj = c(0.5,-0.25), col=2, frame= "none")
edgelabels(losses, adj = c(0.5,1.25), col=4, frame= "none")

ospC amplicon identification

#Index nucleotide file: 
bwa index ref.fa

#align:
bwa mem ref.fa sample_read1.fq  sample_read2.fq > sample.sam 

#BAM output: 
samtools view -b sample.sam > sample.bam

#Sort & index BAM file:
samtools sort -o sample.sorted sample.bam 
samtools index sample.sorted

# Calculate coverage by bedtools (better, raw read coverages)
Based on the update: https://bioinformatics.stackexchange.com/questions/2318/how-to-count-reads-in-bam-per-bed-interval-with-bedtools
bedtools bamtobed -i sample.sorted > sample.bed # bam to bed
bedtools coverage -b sample.bed -a ospC.bed  > sample.coverage

Alternatives (not good):
bedtools coverage -b sample.sorted.bam -a refs.bed -d > sample.bedtools.cov # per-site
bedtools coverage -b sample.sorted.bam -a refs.bed -counts > sample.bedtools.cov # average

# Generate VCF file (not needed for coverage)
samtools mpileup -uf ref.fa s18.sorted.bam s56.sorted.bam > test.mpileup 
bcftools call -c -v test.mpileup > test.raw.vcf

#R plot

# BASH script from Tony Fung & Jamie Cabigas (Spring 2019)

#!/usr/bin/env bash

# ----------------------------------------
# File            : fas-to-vcf.sh
# Author          : Tony Fung & Jamie Cabigas
# Date            : March 21, 2019
# Description     : Batch convert FAS files to VCF files
# Requirements    : samtools 1.9, bcftools 1.9, bwa 0.7.12
# Input           : reference file, format of sequence files, up to 7 sequence id's
# Sample Command  : bash fas-to-vcf.sh ref.fasta fastq ERR221622 ERR221661 ERR221662 ERR221663
# Output          : up to 7 VCF files
# ----------------------------------------

if [ $# -lt 3 ]
then
  echo "Usage: bash $0 <ref_file> <format_of_sequence_files> <sequence_id> [<sequence_id_2> <sequence_id_3> etc.]";
  exit;
fi

for arg
do

  if [ $arg == $1 ]
  then
    ref_file="../$1";
  elif [ $arg == $2 ]
  then
    file_format=$2;
  else
    seq_id=$arg;
    fas_file_1="${seq_id}_1.$file_format";
    fas_file_2="${seq_id}_2.$file_format";

    pwd;
    cd $seq_id;
    pwd;

    # Index nucleotide file:
    bwa index $ref_file;

    # Align:
    bwa mem $ref_file $fas_file_1 $fas_file_2 > $seq_id.sam

    # BAM output:
    samtools view -b $seq_id.sam > $seq_id.bam

    # Sort & index BAM file:
    samtools sort $seq_id.bam -o $seq_id.sorted.bam
    samtools index $seq_id.sorted.bam

    # Generate VCF file:
    # -u is deprecated, use bcftools mpileup instead
    # samtools mpileup -uf $ref_file $seq_id.sorted.bam > $seq_id.mpileup
    bcftools mpileup -f $ref_file $seq_id.sorted.bam > $seq_id.mpileup
    bcftools call -c -v $seq_id.mpileup > $seq_id.raw.vcf

    cd ..;
    pwd;
  fi

done

Running a Screen Session

use byobu

1. start a screen session by typing "byobu"
2. run commands
3. Detach by pressing "F6"
4. Reattach by typing "byobu"
5. Terminate by typing "exit"

use screen

• Start a screen session

screen

• Detach the running mission

ctrl + A + D

• Show the list of running process

screen -ls

• Reattach a running process

screen -r ProcessID

• Terminate a process

ctrl + A
:quit

Bp-utils: sequence, alignment & tree utilities by Qiu Lab

bioseq: sequence/FASTA manipulations

• Use accession "CP002316.1" to retrieve the Genbank file from NCBI. Save the output (in genbank format) to a file named as "cp002316.gb".

bioseq -f "CP002316.1" -o'genbank' > cp002316.gb

• Use the above file as input, extract FASTA sequences for each genes and save the output to a new file called "cp002316.nuc". Use this file for the following questions.

bioseq -i "genbank" -F cp002316.gb > cp002316.fas

• Count the number of sequences.

bioseq -n cp002316.fas

• In a single command, pick the first 10 sequences and find their length

bioseq -p "order:1-10" cp002316.fas | bioseq –l

• In a single command, pick the third and seventh sequences from the file and do the 3-frame translation. Which reading frame is the correct on both? Specify

bioseq -p "order:3,7" cp002316.fas | bioseq -t3

• Find the base composition of the last two sequences

bioseq -p "order:25-26" cp002316.fas| bioseq –c

• Pick the sequence with id "Bbu|D1_B11|8784|9302|1" and count the number of codons present in this sequence

bioseq -p "id:BbuJD1_B11|8784|9302|1" cp002316.fas | bioseq –C

• Delete the last 10 sequences from the file and save the output to cp002316-v2.nuc

bioseq -d "order:17-26" cp002316.fas > cp002316-v2.nuc

• In a single command, pick the first sequence, then get the 50-110 nucleotides and make reverse complement of the sub-sequences

bioseq -p "order:1" cp002316.fas | bioseq -s "50,110" | bioseq –r

• In a single command, get the first 100 nucleotides of all the sequences present in the file and do 1-frame translation of all sub-sequences.

bioseq -s "1,100" cp002316.fas | bioseq -t1

bioaln: alignment/CLUSTALW manipulations

• Go to /home/shared/LabMeetingReadings/Test-Data and find the sequence alignment file “bioaln_tutorial.aln”. Name the format of the alignment file. Use it to answer all the questions below.

CLUSTALW

• Find the length of the alignment.

bioaln -l bioaln_tutorial.aln

• Count the number of the sequences present in the alignment.

bioaln -n bioaln_tutorial.aln

• How do you convert this alignment in phylip format? Save the output.

bioaln -o "phylip" bioaln_tutorial.aln > test.phy

• Pick “seq2, seq5, seq7, seq10” from the alignment and calculate their average percent identity.

bioaln -p "seq2, seq5, seq7, seq10" bioaln_tutorial.aln | bioaln -a

• Get an alignment slice from “50-140” and find the average identities of the slice for sliding windows of 25.

bioaln -s "50, 140" bioaln_tutorial.aln | bioaln -w "25"

• Extract conserved blocks from the alignment.

bioaln -B bioaln_tutorial.aln

• Find the unique sequences and list their ids.

bioaln -u bioaln_tutorial.aln | bioaln -L

• Extract third sites from the alignment and show only variable sites in match view.

bioaln -T bioaln_tutorial.aln | bioaln -v | bioaln -m

• Remove the gaps and show the final alignment in codon view for an alignment slice “1-100”.

 bioaln -s "1, 100" bioaln_tutorial.aln | bioaln -g | bioaln -c

• Add a 90% consensus sequence and then show the final alignment in match plus codon view for an alignment slice “20-80”. (Hint: match view followed by codon view)

bioaln -s "20, 80" bioaln_tutorial.aln | bioaln -C "90" | bioaln -m | bioaln -c

biotree: tree/NEWICK manipulations

biopop: SNP statistics

Homology searching and clustering

BLAST+: search("google") for homologs/pariwise alignment

hmmer

• link: http://hmmer.org/
• Installation: % conda install -c biocore hmmer # Anaconda
• Build profile: hmmbuild globins4.hmm globins4.sto
• Search: hmmsearch globins4.hmm uniprot_sprot.fasta > globins4.out

cdhit

cdhit -i all.pep -o all.cdhit -c 0.5 -n 3

Options:

• -i: input file
• -o: output file
• -c: percent identity (below which it is considered different families)
• -n: word length

interproscan

../../software/interproscan/interproscan-5.13-52.0/interproscan.sh -i trep-cdhit.representatives.pep2 -o  trep-representatives.tsv -t p -goterms -pa -f tsv

Documentation page: How to run

Programs for producing multiple alignments

MUSCLE

MUGSY

• MUGSY bash

#!/bin/sh

export MUGSY_INSTALL=/home/weigang/mugsy_x86-64-v1r2.2
export PATH=$PATH:$MUGSY_INSTALL:$MUGSY_INSTALL/mapping
export PERL5LIB=$MUGSY_INSTALL/perllibs
#For testing TBA
#export PATH=$PATH:$MUGSY_INSTALL/../../multiz-tba/trunk/

• source the bash file

source mugsyenv.sh

• run mugsy

mugsy --directory /home/chongdi/Streptococcus/mugsy-output -prefix mugsy_aln mugsy-input/*.fa

CLUSTALW

MAFT

TCOFFEE

Programs for producing phylogeny & phylogenetic analysis

IQ-Tree

Beginner's tutorial iqtree -s example.phy -m WAG+I+G -bb 1000

FastTree

PHYLIP

MrBayes

RaXML

• Required arguments
  • -s alignment (in PHYLIP or FASTA)
  • -n tag
• Simple run (ML): raxmlHPC-SSE3 -x 12345 -p 12345 -# autoMRE -s concat.fas -m GTRGAMMA -n tag -q part.txt
• Bootstrap: raxmlHPC-SSE3 -f a -x 12345 -p 12345 -# 100 -s concat.fas -m GTRCAT -n tag -q part.txt
• Make a file named "part.txt" with the following lines (Chanlge the number to the total length of your alignment):

DNA, gene1codon1 = 1-3765906\3
DNA, gene1codon2 = 2-3765906\3
DNA, gene1codon3 = 3-3765906\3

• The resulting files
  • RAxML_bestTree.tag: best tree (no bootstrap)
  • RAxML_bipartitionsBranchLabels.tag: ignore
  • RAxML_bipartitions.tag: main result. Feed this tree to figtree
  • RAxML_bootstrap.tag: ignore
  • RAxML_info.tag : log file
• Protein models
  • raxmlHPC-SSE3 -s protein.phy -n A1 -m PROTGAMMAWAS # protein, gamma, Whelan & Goldman (2001) model
  • raxmlHPC-SSE3 -s protein.phy -n A2 -m PROTGAMMAGTR # protein, gamma, user model
  • raxmlHPC-SSE3 -s protein.phy -n A1 -m PROTGAMMAWAG -# 100 -p 0123 # protein, gamma, Whelan & Goldman (2001) model, bootstrap
  • raxmlHPC-SSE3 -s protein.phy -n A1 -m PROTGAMMAWAG -o Carp,Loach # protein, gamma, Whelan & Goldman (2001) model, root on a (monophyletic group)
  • raxmlHPC-SSE3 -s protein.phy -n A1 -m PROTGAMMAWAS -# autoFC -p 0123 # protein, gamma, Whelan & Goldman (2001) model, bootstrap (at least 99 splits, auto-stopping)
  • raxmlHPC-SSE3 -f a -s protein.phy -n A1 -m PROTGAMMAWAG -# 100 -p 0123 -x 0123 # Rapid bootstrap with consensus
    • output 1, RAXML_bestTree.A1 (ml tree)
    • output 2, RAXMLbootstrap.A1 (bootstrap relicates)
    • output 3, RAXMLbipartitions.A1 (tree with boot strap values)

PhyloNet

R packages for phylogenetics

APE

Convert a tree to ultrametric using time estimates

t <- read.tree("core-tree-30otus.dnd")

t.ultra <- chronopl(t, 0)

t.hclust <- as.hclust(t.ultra)

t.dendro <- as.dendrogram(t.hclust)

heatmap(ge.var, Rowv=t.dendro) # order the rows with customized tree

phengorn

phytools

Population genetics

LDHat: test of recombination based on 4-gametes

• filter sites: convert -seq snps.sites -loc snps.locs -freqcut 0.08
• Pairwise LD tests: First generate "lookup" table: lkgen -lk /usr/local/LDhat/lk_files/lk_n50_t0.001 -nseq 48; then calculate pairwise LD statistics: pairwise -seq sites.txt -loc locs.txt -lk new_lk.txt
• Run interval for recombination hot spots: interval -seq sites.txt -loc locs.txt -lk new_lk.txt -its 1000000 -bgen 5 -exact
• Get stats: stat -input rates.txt -loc locs.txt -burn 50 (burnin=100K)
• Plot in R:

x = read.table("rates.txt", skip=1, fill=T);
x = as.matrix(x);
burn.in = 50;
low = as.integer(nrow(x)*burn.in/100);
means<-apply(x[low:nrow(x),], 2, mean, na.rm=T);
q.95<-apply(x[low:nrow(x),], 2, quantile, probs=c(0.025, 0.5, 0.975), na.rm=T);
pos<-as.vector(as.matrix(read.table("locs.txt", as.is=T, skip=1))); 
plot(pos[1:(length(pos)-1)], y=means[2:length(means)], type="s", col=rgb(0,0,0.5),	
     xlab="SNP position (B111)", ylab="Posterior mean recombination rate", main="GBS Strep: recombination by LDhat");
lines(pos[1:(length(pos)-1)], y=q.95[1,2:length(means)], type="s", col=grey(0.75), lty="dotted");
lines(pos[1:(length(pos)-1)], y=q.95[3,2:length(means)], type="s", col=grey(0.75), lty="dotted");

ms: coalescence simulation

SFS: forward simulation

PAML: testing selection with Ka/Ks

Microbial genome databases & pipelines in Qiu Lab

borreliabase

pa2

spiro_genomes/treponema

Blast a set of genes against a bacteria genome

1. download genome
2. extract gene sequences & translate
3. Make blast database
4. Run blastp

de novo variant call with cortex_var

Create binary file of fasta genome file.

Run contex_var_31_c1 (cutoff 1 used for 1 genome)

• --se_list is the command the reads the list you want to target (ie: list-genome.txt)
• --kmer_size is the middle size, has to be an odd integer
• --mem_width always choose 17
• --mem_height always choose 100
• --dump_binary Name your file name (ie: Genome.ctx)

/home/weigang/CORTEX_release_v1.0.5.21/bin/cortex_var_31_c1 
--se_list list-Evo.txt 
--kmer_size 31 
--mem_width 17 
--mem_height 100 
--dump_binary Evo.ctx 
> Evo.log save log file

Read each binary file (.ctx) into its own individual color list (ls Evo.ctx > Evo.colorlist) Then save these lists into their own collective colorlist.txt (ls *.ctx > colorlist.txt)

Reveal genetic variation using the Bubble Caller from cortex_var.

/home/weigang/CORTEX_release_v1.0.5.21/bin/cortex_var_31_c5 
--se_list colorlist.txt 
--kmer_size 31 
--mem_width 17 
--mem_height 100 
--dump_binary all-colors.ctx 
> all-colors.log save log file

Bubble caller will detect differences between each genome by assigning distinct colors to each genome (note that the UK spelling of color is used: colour)

• --multicolour_bin holds your all-colors.ctx binary from the Bubble Caller
• --detect_bubbles1 i/i Detects 1 variation between genomes i and i. i indicates the position number the genome is listed on the colorlist.txt file. If the genome is fourth on the colorlist.txt, for example, its corresponding i variable is 4
• --output_bubbles1 Output variant reads in fasta format (ie: Evo-RefHG.var for bubble detection between

Evolved genome and Reference HG genome)

• --print_colour_coverages necessary for output

/home/weigang/CORTEX_release_v1.0.5.21/bin/cortex_var_31_c5 
--kmer_size 31  
--mem_height 17 
--mem_width 100 
--multicolour_bin all-colors.ctx 
--detect_bubbles1 0/1 
--output_bubbles1 Evo-RefHG.var 
--print_colour_coverages  
> Evo-RefHG.log save log file

Variant call with cortex_var

Example

• Files

MS00018_S5_L001_R1_001.fastq
MS00018_S5_L001_R2_001.fastq
KU-090401_S3_L001_R1_001.fastq
KU-090401_S3_L001_R2_001.fastq
...

• File content

@M03268:52:000000000-AJFAY:1:1101:16970:1555 1:N:0:7
CCCATGAACGGCACGTTCACGATGCAGAAGGTGGTGACCAGGCCGGTGTCGGCGACCTCGACGTAATCGTCGGTGGGGGA
GCCGTCGCGCGGGTCCGCGCCGCGCGGCGGGAAGTACACCTTGCCGTCCATGCGGGCGCGGGCGCCCAGCAGACGACCCT
CCATGAGCGCATTCAGGAATTCGGCCTCCTGCGGCGCGGCGGTGTGCTTGATATTGAAGTCGACCGGGGTCACGATGCCG
GTGACCGGTT
+
11>1>111@11>1A1FGF1FC0F0A111010GB0ECBFGF0/AFECGGFHECE??EEGHE/EEEHEFHEHHGCEECE??/
<CFCGGCCGCCCCCCHCGGCCCG@G??@@?@-@BFFFFFFFFFFF;B@FBFBFF<?@;@@-=?@??@-EFFFFF@;@@@F
FFBF/BBF;@@FFFFFFFFFFFFF@FFFFFFF<@@@@@@@@@@@FBFFFFFFFFFFFFFFFFF@@@?@?@FFFFFFFBF@
?@@EFF@@<B
@M03268:52:000000000-AJFAY:1:1101:16136:1618 1:N:0:7
TCCTGGCCCGTGAAACCGCTTGCCCGGTACAGGTTCTGGACTACCGCCTGGCACCCGAGCATCCGTTCCCGGCGGCGCTC
GACGACGCCGAGGCGGCGTTCCTGGAACTGGTGGCCGCCGGCTACCGGCCCGAACGCATTGCGGTCGCGGGTGATTCGGCCGGTGGCGGGCTCTCGCTCGCGCTGGCCGAACGGCTGCGCGACCGGCACGGGCTGGTTCCGGCCGCGCTCGGGCTGATCGCGCCCTGGGC
+
11>>11C1A@A?11BDF?EEGAFGFG?ECCHBHHGFG1EGHFHHHCCGGC/GCGGGCEECEFGHGGFFGHGGGGCECCC<CCC@CCCC@CGCCCGGC?:@EBFBF/CFFFF0/CFG?=@=-9>AFF@=@@?@;@@@F--9:BF@A@@?@--;9-BFFFF@A-@99B?-9@?=EFFBAAE;9>?;@@BF@9-@-;@=-E@@@=@@;@?>@9@<?@?BBBFFF;?>;;-@@?@<?@?9-FBFF@-99-9E-9
...

Step 1

• Create matched FASTQ files (python script)

#!/usr/bin/python                                                               
  
from sys import argv
script, File1, File2 = argv

# Create a dictionary listing the sequences in the first file for reference
file1 = open(File1)
dict1 = {}
for line in file1:
    if '@M03268' in line:
        tag1 = line.rstrip()[:-9]
        tail = line.rstrip()[-9:]
        dict1[tag1] = []
    else:
        dict1[tag1].append(line.rstrip())
file1.close()

# Create two output files
f1 = open(File1.replace('.fastq', '_mat.fq'), 'w')
f2 = open(File2.replace('.fastq', '_mat.fq'), 'w')

# Match the sequence
file2 = open(File2)
for line in file2:
    if dict1.has_key(line.rstrip()[:-9]): # The has_key method
        tag1 = line.rstrip()[:-9]
        f1.write(tag1 + tail + '\n')
        for j in range(3):
            f1.write(dict1[tag1][j] + '\n')
        del dict1[tag1]
        dict2 = {} # Create a temporary dictionary for sequence in the file2
        tag2 = line.rstrip()
        dict2[tag2] = []
    else:
        dict2[tag2].append(line.rstrip())
    if len(dict2[tag2]) == 3:
        f2.write(tag2 + '\n')
        for j in range(3):
            f2.write(dict2[tag2][j] + '\n')
file2.close()

f1.close()
f2.close()

Step 2. Clean Fastq Files & Run Single-color Graph & Error Cleaning

• Create a file list showing all outcome files whose extensions need to be changed from _mat.fq to .list

bbduk.sh -Xmx1g in1=fastq_file1 in2=fastq_file2 -out1=clean1.fq -out2=clean2.fq qtrim=rl trimq=20

• Create a file list showing all outcome files whose extensions need to be changed from _mat.fq to .list

for f in *_mat.fq; 
do 
  title=$(echo $f | cut -d'_' -f2); 
  id=$(echo $f | cut -d'_' -f1); 
  echo $f > ${id}.list${title}; 
done

• Single color graph for sample

../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c1 
--pe_list MS00018_S5.list1,MS00018_S5.list2 
--kmer_size 31 
--mem_height 17 
--mem_width 100 
--dump_binary MS00018_S5.ctx 
--sample_id MS00018_S5 
--remove_pcr_duplicates 
--quality_score_threshold 20 > MS00018_S5.log

• Single color graph for reference

../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c1 
--se_list ref.filelist 
--kmer_size 31 
--mem_height 17 
--mem_width 100 
--dump_binary ref.ctx 
--sample_id ref 20 > ref.log

• Run Error Cleaning for All Samples (reference is not included)

../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c1 
--mem_height 18
--mem_width 100
--kmer_size 31
--multicolour_bin N18_S15.ctx
--remove_low_coverage_supernodes 10
--dump_binary N18_S15.cleaned.ctx

Step 3

• Pull the name of each .cleaned.ctx file to a cleaned.list file, then create a .filelist file for all cleaned.list files.

ls file1.cleaned.ctx > file1.cleaned.list
ls file2.cleaned.ctx > file2.cleaned.list
ls ref.ctx > ref.list
ls -1 *.list > ref-sample.filelist

• Multicolour Graph

../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c3
--mem_height 20 
--mem_width 100 
--kmer_size 31 
--colour_list ref-sample.filelist 
--dump_binary ref-sample.ctx > ref-sample.log

Step 4

• Variation Discovery Using The Bubble Caller

../../CORTEX_release_v1.0.5.21/bin/cortex_var_31_c3 
--mem_height 20 
--mem_width 100 
--kmer_size 31 
--multicolour_bin ref-sample.ctx 
--detect_bubbles1 -1/-1 
--ref_colour 2 
--output_bubbles1 bubbles-in-sample.out 
--print_colour_coverages 
--experiment_type EachColourAHaploidSampleExceptTheRefColour 
--genome_size 8000000 > bubbles-in-sample.log

Step 5

• Reference Genome

(When in Cluster execute "module load stampy": doesn't work; path problem) (Run the following on wallace:)

stampy.py -G ref ref.fa
stampy.py -g ref -H ref

• Turn Into VCF with reference

Make a sample list file (from bubble or multicolor log file):

cat e1-bubbles-in-sample.log | grep CLEANED | cut -f2 > e1.sample.lis

Customize the following command based on your output files, num of colors, index of ref colors, etc

perl /home/weigang/CORTEX_release_v1.0.5.21/scripts/analyse_variants/process_calls-wq.pl --callfile e1-bubbles-in-sample.out --callfile_log e1-bubbles-in-sample.log -outvcf e1-bubbles-in-sample --outdir e1-vcfout --samplename_list e1.sample.list --num_cols 7 --stampy_bin /home/weigang/stampy-1.0.28/stampy.py --stampy_hash ref --refcol 6 --vcftools_dir /usr/local/bin --caller BC --kmer 31 --ploidy 1

Step 6. Parse VCF files

1. Filter out low-quality sites:

vcftools --vcf pat-5.decomp.vcf --keep-filtered PASS --recode --out pat-5

1. Extract coverage

vcftools --vcf pat-5.recode.vcf --extract-FORMAT-info COV (output file: out.COV.FORMAT)

1. Extract genotypes

vcftools --vcf pat-5.recode.vcf --extract-FORMAT-info GT (output file: out.GT.FORMAT)

1. Extract confidence

vcftools --vcf pat-5.recode.vcf --extract-FORMAT-info GT_CONF (output file: out.GT_CONF.FORMAT)

1. Send GT_CONF file to R and visualize log10(conf) distribution with boxplot
2. Use custom PERL file to filter out low-quality (e.g., GT_CONF < 30) genotype calls (flag with "?" or "na"), and make haplotype GT ("1/1" to "1", "0/0" to "0", "./." to "?)
3. Verify variants using IGV (see IGV protocol above)

Step 7. Variant Annotation & Visualization

1. vcf_parser.py out.decomp.vcf ref.gb (the code needs validation)
2. Data to database & web visualization, if necessary

hmmer

Annotate proteins with TIGRFAM

hmmsearch --tblout foo.hmmout   # table output for all sequences
          --domtblout foo.dmout # table output for all domains
          -E 0.01               # level of sequence significance
          --domE 0.01           # level of domain significance
          -o /dev/null          # don't show STDOUT 
          ../../TIGRFAMs-Release-15-Sep-17-2014/TIGRFAMs_15.0_HMM.LIB # HMM profile library for tiger fams 
          GCA_000583715.2_ASM58371v2_protein.faa &                    # input/query file in FASTA

PopGenome

library(PopGenome)
g = readVCF("pvt1.recode.vcf.gz", 1000, "8", 127890000, 128102000)
pops = split(sample[,1], sample[,2]) # create a list of populations
g = set.populations(g, pops, diploid = T) # set population names

# by windows
slide = sliding.window.transform(g, width = 100, jump = 20) # nsnps, not actual length
slide = F_ST.stats(slide, mode = "nucleotide")
snp.pos = slide@region.data@biallelic.sites # SNP positions
win.num = length(slide@region.names)
win.start = numeric()
for (i in 1:win.num) {win.start[i] = snp.pos[[i]][1]}
fst = slide@nuc.F_ST.vs.all
pop.names = names(slide@populations) # population names
plot(win.start, fst[,1], type ="n", las = 1, ylab = expression(F[st]), xlab = "SNP Position", ylim = c(0,0.4))
for (i in 1:length(slide@populations)) {
  lines(win.start, fst[,i], type = "l", col = pop.group[pop.names[i],4])
}
arch.coords=c(127982050, 127992931)
abline(v = arch.coords, col = "orange")
#rect(xleft = arch.coords[1], ybottom = -1, xright = arch.coords[2], ytop = 0.5, border = "transparent", col = 2)

Velvet

Cleaning

../../bbmap/bbduk.sh -Xmx1g 
           in1=WGC067462_hunhewenku_509_combined_R1.fastq # gz file works as well
           in2=WGC067462_hunhewenku_509_combined_R2.fastq # gz file works as well
           -out1=clean1.fq 
           -out2=clean2.fq 
           qtrim=rl
           trimq=20

Running Velvet Optimizer

srun ../../VelvetOptimiser-2.2.5/VelvetOptimiser.pl 
          --t 32
          --s 31 --e 31 --x 6 # kmer sizes
          -f '-shortPaired -fastq clean1.fq -shortPaired2 -fastq clean2.fq'
          -t 4 
          --optFuncKmer ‘n50’ 
          -p prefix

PacBio assembly with canu

./canu -p staph-auto-5 -d staph-auto-5 genomeSize=2.2m -pacbio-raw pac-reads-5.tar.gz